LOADING

Predicted RdRp-trapping structures for all constructs of Funk et al. 2024

made using slidingfold version 25/07/10

This file contains transient RdRp-trapping RNA structure predictions for all sequences used in Funk et al 2024. This file requires a working internet connection to load since jQuery and plotly.js code is not embedded to reduce file size.

The following parameter models were used for folding (from inner to outer ∆G heatmap):

parameter setfootprintactive site locationnts on each side
120510
220515

Lonely RNA pairs were forbidden and the RdRp footprint was replaced by an arbitrary sequence with folding constraint (x is unpaired, parentheses indicated forced pairs):

 AAGGGGGGAAAACCCCCCAA
 xx((((((xxxx))))))xx

The "Go To..." menu at the top left allows to quickly navigate to a specific graph via a sidebar table of content. Checkboxes next to each graph allow to show or hide the graph and the buttons at the top allow to hide or show all graphs at once. Clicking on the name of a hidden graph will set it to be shown and move the view over to the graph. Clicking on the name of a subcategory will cause all associated graphs to be shown and move the view to the first graph of that subcategory. To close the sidebar, simply click anywhere outside it.

Hovering over different parts of the graphs provides additional information, such as model parameters, ∆G, and predicted RdRp-trapping structure. To zoom into a particular part of the figure, click-and-drag your mouse across it. To reset the zoom, double-click in an empty area of the graph. To see the entire graph, double-click in an empty area while at the default zoom level. Zoom levels can also be controlled via the menu in the upper-right corner of the graph.

At the bottom of the graph, the cursor changes into a horizontal double arrow, clicking and dragging allows to move the displayed region left or right.

footprint: 20 nts, active site in position 5 10 nts on each side for folding position 1045 ∆G= -7.90 kcal mol -1 AUGUCCCUCAAAGAGAAACAAGAGGACUAUUUGGGGCUAU ..{<{{{...[---GAAACAAGAG-----]..}}}>}... Predicted cRNA structures(10 nucleotide window) Predicted cRNA structures(15 nucleotide window) Predicted vRNA structures(15 nucleotide window) Predicted vRNA structures(10 nucleotide window) Amino acid sequence cRNA sequence cRNA position Structure infobox appears when hovering over heatmap Nucleotides: Amino acids (ClustalX color scheme): RNA structures ∆G (kcal mol -1 ) Adenine Purines Hydrophobic Uracyl Cytosine Guanine Alanine Leucine Isoleucine Phenylalanine Methionine Lysine Arginine Glutamate Aspartate less stable more stable Tryptophane Valine Asparagine Threonine Serine Glutamine Cysteine Histidine Tyrosine Stop codon Proline Glycine cRNA position vRNA sequence RdRp model parameters Position and free energy,lower is more stable Sliding window size RdRp footprint Nucleotide in RdRp active site Matched bracketsrepresent base pairs: Periods representunpaired nucleotides Pyrimidines Polar Aromatic Positivecharge Negativecharge 0 -14 -12 -10 -8 -6 -4 -2 990 1000 1040 1050 1040 990 1000 1040 1050 1040 C C U C A A A G A G A A A C A A G A G G A C U A P Q R E T R G L G G A G U U U C U C U U U G U U C U C C U G A U 1060 1060 {} () <> G-C base pair A-U base pair G-U base pair Strength of base pair C U A G S L F Y W C * P Q R H I K N T V E D A G M

Full-length predictions are provided for all LPAIV HAs, with a window of 81 nucleotides encompassing the HA cleavage site being shown by default. For mutated HA sequences, only the region containing altered stems (or at minimum the 81 nucleotides encompassing the HA) is shown.